This is somewhat similar to #744 , but they are totally different.
An example is https://www.ncbi.nlm.nih.gov/sra/SRR31443117, containing 173,536 reads. It is a mixture of two primer sets targeting adjacent but different regions.
The first primer set is:
Command line parameters: -a GTCGGTAAAACTCGTGCCAGC;required...CAAACTGGGATTAGATACCCCACTATG;optional --no-indels -e 4.5
Output:
Total reads processed: 173,536
Reads with adapters: 44,695 (25.8%)
The second primer set is:
Command line parameters: -a ACTGGGATTAGATACCCC;required...CTAGAGGAGCCTGTTCTA;optional --no-indels -e 4.5
Output:
Total reads processed: 173,536
Reads with adapters: 144,909 (83.5%)
How to deal with such situation efficiently? Run with two steps and combine them seems does not appropriate, since there is a small overlap between these two groups (25.8% + 83.5% = 109.3% > 100% )
This is somewhat similar to #744 , but they are totally different.
An example is https://www.ncbi.nlm.nih.gov/sra/SRR31443117, containing 173,536 reads. It is a mixture of two primer sets targeting adjacent but different regions.
The first primer set is:
Output:
The second primer set is:
Output:
How to deal with such situation efficiently? Run with two steps and combine them seems does not appropriate, since there is a small overlap between these two groups (25.8% + 83.5% = 109.3% > 100% )